pcpgrich lacz (InvivoGen)
InvivoGen is a verified supplier 
InvivoGen manufactures this product 
90
Structured Review
InvivoGen
pcpgrich lacz
Pcpgrich Lacz, supplied by InvivoGen, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcpgrich+lacz/pCpGrich-mcs/pmc10213191-243-88-83
Average 90 stars, based on 5 article reviews
Pcpgrich Lacz, supplied by InvivoGen, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcpgrich+lacz/pCpGrich-mcs/pmc10213191-243-88-83
Average 90 stars, based on 5 article reviews
pcpgrich lacz - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: 704/DNA vaccines leverage cytoplasmic DNA stimulation to promote anti-HIV neutralizing antibody production in mice and strong immune response against alpha-fetoprotein in non-human primates Article Snippet: .. The pCMV-LacZ plasmid (Clontech, St Germain en Laye, France), encodingβ-Gal under the control of the human cytomegalovirus (CMV) immediate-early gene promoter, was used as antigen. pCMV-LacZ-miR133a-3p and pCMV-LacZ-miR142a-3p were constructed by cloning four miRNA 133a-3p targeting sequences (forward, cagctggttgaggggaccaaa; reverse, tttggtcccctcaaccagctg) or four miRNA 142a-3p targeting sequences (forward, tccataaagtaggaaacactaca; reverse, tgtagtgtttcctactttatgga) into the 3′ UTR of the LacZ gene, which inhibit respectively the expression on muscular fibers or DCs. Control:Article Title: 704/DNA vaccines leverage cytoplasmic DNA stimulation to promote anti-HIV neutralizing antibody production in mice and strong immune response against alpha-fetoprotein in non-human primates Article Snippet: .. The pCMV-LacZ plasmid (Clontech, St Germain en Laye, France), encodingβ-Gal under the control of the human cytomegalovirus (CMV) immediate-early gene promoter, was used as antigen. pCMV-LacZ-miR133a-3p and pCMV-LacZ-miR142a-3p were constructed by cloning four miRNA 133a-3p targeting sequences (forward, cagctggttgaggggaccaaa; reverse, tttggtcccctcaaccagctg) or four miRNA 142a-3p targeting sequences (forward, tccataaagtaggaaacactaca; reverse, tgtagtgtttcctactttatgga) into the 3′ UTR of the LacZ gene, which inhibit respectively the expression on muscular fibers or DCs. Construct:Article Title: 704/DNA vaccines leverage cytoplasmic DNA stimulation to promote anti-HIV neutralizing antibody production in mice and strong immune response against alpha-fetoprotein in non-human primates Article Snippet: .. The pCMV-LacZ plasmid (Clontech, St Germain en Laye, France), encodingβ-Gal under the control of the human cytomegalovirus (CMV) immediate-early gene promoter, was used as antigen. pCMV-LacZ-miR133a-3p and pCMV-LacZ-miR142a-3p were constructed by cloning four miRNA 133a-3p targeting sequences (forward, cagctggttgaggggaccaaa; reverse, tttggtcccctcaaccagctg) or four miRNA 142a-3p targeting sequences (forward, tccataaagtaggaaacactaca; reverse, tgtagtgtttcctactttatgga) into the 3′ UTR of the LacZ gene, which inhibit respectively the expression on muscular fibers or DCs. Cloning:Article Title: 704/DNA vaccines leverage cytoplasmic DNA stimulation to promote anti-HIV neutralizing antibody production in mice and strong immune response against alpha-fetoprotein in non-human primates Article Snippet: .. The pCMV-LacZ plasmid (Clontech, St Germain en Laye, France), encodingβ-Gal under the control of the human cytomegalovirus (CMV) immediate-early gene promoter, was used as antigen. pCMV-LacZ-miR133a-3p and pCMV-LacZ-miR142a-3p were constructed by cloning four miRNA 133a-3p targeting sequences (forward, cagctggttgaggggaccaaa; reverse, tttggtcccctcaaccagctg) or four miRNA 142a-3p targeting sequences (forward, tccataaagtaggaaacactaca; reverse, tgtagtgtttcctactttatgga) into the 3′ UTR of the LacZ gene, which inhibit respectively the expression on muscular fibers or DCs. Expressing:Article Title: 704/DNA vaccines leverage cytoplasmic DNA stimulation to promote anti-HIV neutralizing antibody production in mice and strong immune response against alpha-fetoprotein in non-human primates Article Snippet: .. The pCMV-LacZ plasmid (Clontech, St Germain en Laye, France), encodingβ-Gal under the control of the human cytomegalovirus (CMV) immediate-early gene promoter, was used as antigen. pCMV-LacZ-miR133a-3p and pCMV-LacZ-miR142a-3p were constructed by cloning four miRNA 133a-3p targeting sequences (forward, cagctggttgaggggaccaaa; reverse, tttggtcccctcaaccagctg) or four miRNA 142a-3p targeting sequences (forward, tccataaagtaggaaacactaca; reverse, tgtagtgtttcctactttatgga) into the 3′ UTR of the LacZ gene, which inhibit respectively the expression on muscular fibers or DCs. |